![]() ![]() Langlois developed a fractional formula for computing the saturation vapor pressure of water and compared the results with the observed values in Byers (1959) and the formula in Berry et al. Bosen gave a formula for calculating the saturation vapor pressure of water with reasonable accuracy in the temperature range from −51.1° to 54.4☌ ( Bosen 1960). There has been much research on formulating the saturation vapor pressure. The Goff–Gratch, Hyland–Wexler, and Wagner–Pruss formulas are tedious and inconvenient for use in calculating the saturation vapor pressure. When large-scale computations are needed or temperatures with decimal points are reported, it is routine to calculate the saturation vapor pressure by using an accurate formula. ![]() The values of saturation vapor pressure can be obtained by looking them up in the reference tables. The IAPWS adopted it soon thereafter ( IAPWS 2011). developed a new equation, which has considerably less uncertainty, for calculating the saturation vapor pressure of ice ( Wagner et al. Wagner and Pruss developed a new formulation for the thermodynamic properties of ordinary water substance for general and scientific use, and later this formulation was adopted by the International Association for the Properties of Water and Steam (IAPWS) ( Wagner and Pruss 1993, 2002 IAPWS 2016). Later, this formula and the computed values were incorporated in the ASHRAE Handbook-Fundamentals ( Wexler 1976 Hyland and Wexler 1983 ASHRAE is derived from the American Society of Heating, Refrigerating, and Air-Conditioning Engineers). Wexler and Hyland obtained new laboratory data on the saturation vapor pressure of water and derived another lengthy formula. In 1966 the World Meteorological Organization (WMO) recommended its use, and the WMO meteorological tables were based on these formulas ( Letestu 1966). Goff and Gratch developed an accurate formula for calculating the saturation vapor pressure ( Goff and Gratch 1945), and modified this formula later ( Goff 1957). The saturation water vapor pressure, which is a function of air temperature, provides a basis for determining other thermodynamic properties of moist air (humidity ratio, specific enthalpy, specific entropy, specific volume, etc.). The latter condition is called saturation, a state of neutral equilibrium between moist air and the condensed water phase ( ASHRAE 2013, chapter 8). The amount of water vapor in moist air changes from zero to a maximum that relies on the temperature and pressure of atmospheric air. Moist air is a mixture of dry air and water vapor. The composition of dry air is relatively unvarying. Dry air exists when all water vapor has been removed from atmospheric air. Therefore, this new formula has significant advantages over the improved Magnus formula and can be used to calculate the saturation vapor pressure of water and of ice in a wide variety of disciplines.Ītmospheric air consists of a number of gaseous components (e.g., nitrogen, oxygen, carbon dioxide, inert gas, and water vapor). In addition, this new formula yields a mean relative error of 0.0005% within the commonly occurring temperature range (10°–40☌). In comparison with the International Association for the Properties of Water and Steam reference dataset, the mean relative errors from this new formula are only 0.001% and 0.006% for the saturation vapor pressure of water and of ice, respectively, within a wide range of temperatures from −100° to 100☌. This new formula is simple and easy to remember. In this study, a new formula has been developed by integrating the Clausius–Clapeyron equation. These formulas either are tedious or are not very accurate. A number of formulas are available for this calculation. Although it isn't trivial in general, you can check how the formula simplifies for processes mentioned below.It is necessary to calculate the saturation vapor pressure of water and of ice for some purposes in many disciplines. The general formula for work done by the gas is expressed as ∫p(V)dV if we consider pressure as the function of volume. These parameters in real gases differ from theoretical ones, but we already contain them in our thermodynamic processes calculator. R for gases with more complex molecules.ΔT, where Cv is molar heat capacity under constant volume.Internal energy change is proportional to temperature variation ΔT and type of gas with the following equation: ΔU = Cv Still, it is possible to find thermal energy changes ΔU, which are described by the first law of thermodynamics: ΔU = Q - W, where Q denotes heat absorbed, and W is work done by gas. It's quite tricky to estimate the precise value of internal energy. Internal energy U is the sum of all kinds of energy present in a system. ![]()
0 Comments
![]() ![]() Then, while you are doing this, you easily easily max out Smithing which will give you amazing physical damage resistance and Alteration, which allows you a 30% magic resistance and 30% spell absorption. It makes money meaningless as you can buy iron ore, transmute it to gold, craft gold necklaces, and sell them for more than you paid for the ore. Transmute Ore + insane availability of Iron Ore = Breaks the game almost. Elder Scrolls Reading Club (Community Playthrough).Tag your submissions! Place any of the following tags in the title of your post to highlight it.Pictures of your cat with the title "khajiit has wares if you have coin".Handprints, in any way, shape or form, even if posted by reddit admins, though certain handcrafts are permitted.Any posts related to Piracy (Support the game creators!).Screenshots of texts, facebook or other social networking sites (jokes on facebook, 4chan images) or comments with Skyrim quotes from other subreddits (i.e.Locations or Items in real life that remind you of Skyrim (dark brotherhood hand prints, sweetrolls), though crafts are permitted.Screenshots with anything superimposed on the image (text, real life items).Repeat violators of this rule will be banned and reported to the site admins. Make sure content you submit is broadly interesting, not spammy, and contributes directly to the community. Per Reddit's Guidelines for self promotion, no more than 10% of the content you submit to the subreddit should be your own.Other interesting videos are allowed, but are still subject to rules 3 and 5. No YouTube/Twitch channel advertising/LP spamming. ![]() No Low Effort Content such as Handprints, Meridia's beacon, etc.A subreddit dedicated to the Elder Scrolls V: Skyrim. ![]() ![]() Looking only on a calendar year basis, data back to 1900 indicates the probability of a loss slides to just 20% in Australian shares and 26% for US shares. But if you only look monthly and allow for dividends, the historical experience tells us you will only get bad news around a third of the time. So day by day, it’s pretty much a coin toss as to whether you will get good news or bad news. See the next chart for Australian and US shares. If you look at the daily movements in the share market, they are down almost as much as they are up, with only just over 50% of days seeing positive gains. Key message: market timing is great if you can get it right, but without a process the risk of getting it wrong is very high and, if so, it can destroy your longer-term returns. Hence the old cliché that “it’s time in that matters, not timing”. If you miss the 40 best days, it drops to just 3.3% pa. For example, if by trying to time the market you miss the 10 best days (blue bars), the return falls to 7.4% pa. But this is very hard to do, and many investors only get out after the bad returns have occurred, just in time to miss some of the best days and so end up damaging their longer term returns. If you avoided the 40 worst days, it would have been boosted to 17.5% pa. If by trying to time the market you avoided the 10 worst days (yellow bars), you would have boosted your return to 12.5% pa. The next chart shows that if you were fully invested in Australian shares from January 1995, you would have returned 9.5%pa (including dividends but not allowing for franking credits, tax and fees). A good way to demonstrate this is with a comparison of returns if an investor is fully invested in shares versus missing out on the best (or worst) days. But without a proven asset allocation or stock picking process, trying to time the market is very difficult. In times of uncertainty its temping to try and time the market, ie to sell ahead of falls & buy in anticipation of gains. This note continues our updated series that began with “ Five great charts on investing”. But the basic principles of investing are simple and timeless and can be particularly useful to bear in mind in times like this. As the US economist JK Galbraith once said “there are two types of economists – those that don’t know and those that don’t know they don’t know.” And this is certainly an environment where much is unknown. I will be the first to admit that my crystal ball is even hazier than normal in times like the present. Successful investing can be really hard in times like the present when share markets are down sharply & very volatile on the back of uncertainty around inflation, rising interest rates and the war in Ukraine. ![]() ![]() As a note, I had already modified the field's name attribute and the adjacent labelling by this stage to remove references to the triggering keywords or their variants. I found for example modifying the placeholder text from 'Please enter your username.' to 'Please enter your user-name.' prevented the browser from recognizing the field as a username field – also notice the hyphen between the words user and name – without the hyphen between the words – the popup still appeared, so it shows how may edge cases the browsers are checking for. While I was not as surprised to see the popup being activated by the tag's name or placeholder attribute values, I was surprised to see that label text was considered too by the browser, as such I had to change the wording and labelling of the fields to ensure the popups did not appear. The label text does not need to be placed into a tag to have this effect - just to be in close proximity to the field, although I haven't had opportunity to extensively test and determine what is considered 'close proximity' - this will require some further research and experimentation or where possible, review of the various web browser rendering engines' source code - such as for WebKit.Īs such if you have keywords word such as username, user name, login or similar variants, as well as variants for password, the browser will show the autocomplete popup when the field is focussed, despite any CSS rules to try and hide it! I found that the browser is not only checking the tag's name attribute for keywords such as username, login and similar variants, but also appears to consider the contents of any placeholder attribute text on the field, as well as most surprisingly, any text adjacent to the field such as that used as a form field label. Chrome, Firefox, etc), that even if the various CSS workarounds to hide the autocomplete popups are in place, if the field appears to be a username or password field to the browser, then the autocomplete field still appears. ![]() It should be noted that in Safari (version 11+ at least, and likely earlier versions too, and other recent browsers, e.g. As a note – check your field labels and any placeholder attribute values too – as these can also cause autocomplete popups to appear, despite CSS styling rules being applied to the contrary. ![]() ![]() Payment has to be made in HRK (cash or credit card) according to the current exchange rate.What's nearby Beach Brela Beach 0.29km Punta Rata Beach 0.40km Dubovica 40.48km Mountain Biokovo 10.58km Cit圜entre Makarska City Centre 11.06km Split City Centre 42.61km Fort Starigrad Fortress 20.66km Airport Bol Airport 22.12km Stadium Stadion Gospin Dolac 24.77km Stadion Hrvatski Vitezovi 37.53km Stadion Park Mladezi 42.49km Stadion Stari Plac 42.88km Square Central Square 25.12km Fruit's Square 42.44km Narodni Trg 42.47km Prokurative 42.64km Bridge Rascane Viaduct 25.32km Dive Centre Big Blue Diving 26.00km Historic Site Stari Grad Plain 31.38km Salonae 41.40km Old Split 42.39km School School of Medicine, University of Split 40.22km Suburb Bacvice 41.14km Museum Croatian Maritime Museum 41.86km City Museum of Split 42.30km Ethnographic Museum 42.32km Archaeological Museum 43.03km Port Port of Split 42.06km Marina Riva Harbor 42.17km Market Green Market 42.24km Cathedral Cathedral of Saint Domnius 42.30km Statue Gregory of Nin 42.31km Historic Building Grisogono - Cipci Palace 42.31km Nakic Palace 42.51km Street Let Me Pass Street 42.36km Kresimirova Street 42.38km Art Gallery Gallery of Fine Arts 42.39km Palace Diocletian's Palace 42.42km Clock Tower City Clock 42.42km Theatre Croatian National Theatre in Split 42. In case you order supplement meals on site at Bluesun Hotel Maestral, the price of lunch or dinner is 16 EUR per person. Transfer service and excursions around the region can be arranged at an additional cost.Īmounts of the lunch and dinner supplements listed in the booking confirmation are only valid for online bookings. Tennis and volleyball courts, bike rental services and paragliding facilities can also be found in Brela. ![]() There is a wellness centre at the nearby Bluesun Hotel Soline. Live music is often organised on the summer terrace. Bluesun Hotel Maestral Filipinska bb, 21322 Brela, Croatia Excellent location - show map 9.1 Superb 320 reviews The hotel is beautifully renovated right in front of the beach. The lounge bar serves alcoholic drinks, soft drinks and cocktails. Search over 2.9 million properties and 550 airlines worldwide. ![]() Save an average of 15 on thousands of hotels with Expedia Rewards. A combination of traditional Mediterranean and continental dishes is served buffet-style for breakfast and dinner. Bluesun Hotel Maestral A great choice for a stay in Brela, Bluesun Hotel Maestral features an airport shuttle and a free kids club. Croatia Hotels Plan your trip Find hotels in Brela from 65 Check-in Check-out Guests Most hotels are fully refundable. ![]() The large hotel restaurant boasts a magnificent view of the sea. Satellite TV, minibar and safety box are featured in all rooms, which have a bathroom with hairdryer as well. Bluesun Hotel Maestral in Brela is located in pinewood near pebble beach in Brela near Makarska in Dalmatia in Croatia. It is right by the beach, same as the Maestral Snack Bar with terrace, where you can enjoy sea views and a wide selection of delicious pizzas, aperitifs and cocktails. Find all information and best deals of Bluesun Hotel Maestral, Brela on Book the hotel with real traveler reviews, ratings and latest pictures of. ![]() The elegant Punta Rata Restaurant offers Croatian and Dalmatian à la carte. It enjoys a tranquil location within lush Mediterranean pine trees. Featuring a large outdoor pool and a poolside terrace with bar and loungers, Bluesun Hotel Maestral offers air-conditioned rooms with free Wi-Fi and balcony just steps away from the magnificent Punta Rata pebble beach. Hotel is situated a 2 minute walk away from a delightful beach and paved promenade which left or right leads to countless beaches/bars/resorts for miles- the nearest Brela has a picture postcard marina and good selection of restaurants with good food at a range of prices. ![]() ![]() ![]() This bullying, beating, and tormenting resulted in my having a firm conviction that these behaviors are intolerable and that cultural sensitivity to people of all backgrounds is vital, not just in teaching but in life as well. My first few years were marred by beatings by gangs of boys and girls supported by specific teachers and administrators, ceasing only after an ACLU lawsuit was initiated. in New Rochelle, N.Y., near Interstate 95, changed hands for an undisclosed amount.I began my education in the Berkley school system at Tyndale elementary school in northern Oak Park, Michigan. in Malden, Mass., outside Boston, sold for $26 million, and a three-story structure at 479 Fifth Ave. A 125,388-square-foot asset located at 490 Eastern Ave. in Brooklyn, changed hands for $48.8 million and was the largest self storage transaction recorded in the New York metro area through October, according to CommercialEdge. One of the deals, a 139,300-square-foot building located on a 1-acre parcel at 5002 Second Ave. In March, the REIT acquired a three-property self storage portfolio totaling 3,596 units in the New York and Boston markets from Banner Real Estate Group. The earnings report stated the 12 properties that are still to be constructed by Beyond Self Storage will be acquired for $193.9 million, and closings will occur as they are completed next year. 30, Public Storage acquired or agreed to acquire 54 self storage facilities across 18 states-including the 36-property portfolio from Beyond Self Storage-totaling 4.9 million square feet for $686.9 million. Those assets are located in Ohio, California, Minnesota, New York, Tennessee, Colorado, Florida, Indiana, Massachusetts, Nebraska and Utah, according to the company’s third-quarter earnings report released in early November.Īfter the end of the third quarter on Sept. During the first nine months of 2020, the REIT acquired 19 self storage facilities totaling 1.4 million square feet for $282.4 million. During the third quarter, Public Storage acquired four facilities-two in Minnesota and one each in Colorado and Utah-for $29.1 million. states and totaling approximately 171 million square feet. ![]() 30, Public Storage had interests in 2,504 self storage facilities located in 38 U.S. He said the company is committed to expanding its portfolio and brand through organic and external growth including acquisitions, development, redevelopment and third-party management.Īs of Sept. Joe Russell, Public Storage CEO, said in a prepared statement the high-quality Beyond Self Storage assets will enhance the REIT’s strong and diversified portfolio. The REIT has grown its holdings by 9 percent during that time. Since the beginning of 2019, Public Storage has added approximately 13.9 million square feet through $1.9 billion in acquisitions, development and redevelopment, including properties currently under contract. Capitalizing on its brand, operating scale and balance sheet, Public Storage has been actively expanding its portfolio through acquisitions for more than a year. Locations of the properties were not disclosed but Public Storage officials said the two-phase portfolio acquisition was part of the Glendale, Calif.,-based REIT’s continued opportunistic growth strategy. Public Storage, the leading owner, developer and operator of self storage properties in the U.S., will acquire those assets when they are completed in 2021. The remaining 12 properties, totaling 1.3 million square feet, are in various stages of development. ![]() The first phase includes existing properties built since 2016, with an average occupancy of approximately 35 percent. Public Storage has acquired 24 properties with 2.3 million square feet of space from Beyond Self Storage in the first phase of a 36-property portfolio transaction totaling 3.6 million square feet and valued at $528 million. ![]() ![]() ![]() Whatever your organizational size, translation requirements, or budget constraints, Xerox Easy Translator Service is the perfect match. We provide great incentives for copier referrals past. Competing in a global economy means working with multilingual documents. In addition, to learn more about how USA Copier Lease can help your organization assess your existing copier leases or provide a quote for new copier, call (800) 893 1183 or send an email to you have read this far and are an IT organization looking for a Xerox Partner to pass referrals to, Contact us. We can service and support your Xerox devices anywhere in the United States with a guaranteed same day / next day on-site service guarantee. USA Copier Lease is an exclusive Xerox dealer and our clients are across the United States. Contact us at or visit our online store for more prices at Looking for a new Xerox? Click the picture below for ordering! If you don’t have a new Xerox, we can lease / sell you a brand new Xerox. Translate your quote in real time to a potential customer.Īny Xerox that is Connect Key Enabled – meaning any new Xerox – can have the Easy Translator App installed and configured. Translate and present helpful information to customers on safety and recall notices. Post Warnings/Notifications/Alerts in multiple languages Translate Employee Forms/Posters/Announcements in employee languages XEROXS EASY TRANSLATOR SERVICE offers four tiers of language. Translate in real time client provided documents for review/case submital Maybe you have something other than a Word doc PowerPoint Excel PDF Jpg Gif And more. What business / department would benefit from this APP? So I guess if you are a Restaurant, this would be helpful. Gateway to New Possibilities Instantly extend your capabilities with real-world apps from the Xerox App Gallery, or talk with one of our partners to design and develop a solution specific to your business needs. Enables remote monitoring of service delivery and consumables. So the waitress finally figured out what he was trying to convey and used her Easy Translator App to translate the menu in real time. Easy integration of XeroxIntelligent Workplace Services. The Xerox Instant Transfer Enabled Machine does seem useless to most at first glance…and I think Xerox thought this also so they made a video about a French speaking person was trying to order off the menu in English but has having difficulties. Also, now would be a good time to tell you that your Xerox Copier/Printer can have app’s installed onto it. The following versions: 1.7 and 1.6 are the most frequently downloaded ones by the program users. This program is a product of Xerox Easy Translator Service. We recommend checking the downloaded files with any free antivirus. If you don’t know, there is an App that you can install onto your Xerox that turns your copy machine/printer into a real time translating machine. Xerox Easy Translator Service is sometimes distributed under different names, such as 'Xerox Easy Translator Service'. This app uses state-of-the-art technology to deliver instant translations. ![]() So I have been reading a lot about the Xerox Easy Translator App. A faster, easier way to translate and retain original layout. ![]() ![]() ![]() This definition appears very rarely and is found in the following Acronym Finder. ![]() As no active threats were reported recently by users, is SAFE to browse. SOCSs form SBC-Cul5/E3 complexes, and VHL forms a VBC-Cul2/E3 complex. This website is estimated worth of 8.95 and have a daily income of around 0.15. What does SOCSS stand for SOCSS stands for Statement of Creditable Sea Service (US Coast Guard) Suggest new definition. SOCSs recruit Elongin C, Elongin B, Cullin5(Cul5), and Rbx2, whereas VHL recruits Elongin C, Elongin B, Cul2, and Rbx1. The use of clothing labels of which DROPS DESIGN forms part is. New search features Acronym Blog Free tools '. Race horse Swift Socks is by Swift Apollo (AUS) out of A-la-carte (AUS). Australia Merino Wool: The mens hiking socks are made of 53 Organic Merino Wool, 25 Nylon. It is a social decision-making process designed to help students on the autism spectrum and with other disabilities understand social situations. It has to be clearly stated that the garment is made based on a design from DROPS DESIGN. Swift Socks is a thoroughbred horse born in Australia in 1987. Please Request a free coupon code via this link. ![]() Draws or creates marks, lines, rectangles, polygons, circles, ellipse, arcs, ellipse arcs, splines, strings, text, dimensions, leader note, images, groups, blocks, or any misc. Situations-Options-Choices-Consequences-Strategies-Simulation (SOCCSS) Program is a strategy developed by Jan Roosa according to Myles and Aderon ( 2001 ).Easily zoom in and out and move with mouse wheel.Simplified user interface makes it easy to learn and use. ![]() SOCSS can be extended, by writing your own custom macros in the AppleScript programming language. U.S.A.SOCSS is a powerful feature-packed 2D vector drawing software, so that it can be used for drawing, landscape design, newsletters, brochures, graphs & charts, fine illustrations, office or furniture layouts, business cards, forms signs, etc. feet wearing white socks with red heart shape. The Ss-5 Application for Social Security Card form is 5 pages long and contains: Search from thousands of royalty-free Socks stock images and video for your. On average this form takes 14 minutes to complete Download scientific diagram (Figure continues on the opposite page.) from publication: Twenty proteins containing a C-terminal SOCS box form five structural classes The four members of the. Ss-5 Application for Social Security Card All forms are printable and downloadable. Unlike the eight SOCSs proteins that contain an SH2 domain, these classes of proteins contain either WD-40 motifs (WSB proteins), a SPRY domain (SSB proteins), ankyrin repeats (ASB proteins), or a GTPase domain N-terminal of the SOCS box (Fig. Once completed you can sign your fillable form or send for signing. Use Fill to complete blank online SOCIAL SECURITY ADMINISTRATION (MD) pdf forms for free. soc, or stream of conscious, is a term adopted by fans to describe free-form lyrics frequently performed by amy in the 1980s and 1990s. Fill Online, Printable, Fillable, Blank Ss-5 Application for Social Security Card Form ![]() ![]() AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCIGGCACGACAGGITTCC CGACIGGAAAGCGGGCAGTGAGCGCMACGCAATTAATGEGAGTTAGCTCACTCATTAGGCACCCCAGGCITTA CACTITATGCITCCGGCTCGTATGTTGTGTGGAR AGCGGATAACAATTTCACACAGGNANCAGCTATG ACCATGATTACGCCAAGCTATTTAGGEGACACT GAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGOC GTGCTGG CAGATATCC CACACTGGCGGCCGCTCGNGCA TGCATCEAGAGGGOCCAATTCGCCCTATAG GAGTCGTATTACAATTCACIGGCCGTCGETTTACAACGTCGT GACTGGGAAAACCCTGGCGT TTAAT cccc GCTGGCGTAATA GCGAAGAGGCCCGCACCGATCGCCCIICCCAAC GCGCAGCCTATACGTACGGCAGITTMAGGTTTACAC CTATAMAAGAGAGAGCCGTT. It provides tools with an intuitive interface that assists you in DNA cloning, sequence analysis and visualization. Remember the more facts you can discern from the sequence the more points you get. Serial Cloner is a molecular biology software. ![]() For example, your sequence analysis can contain the location of enzyme digestion sites, the number and size of any open reading frames, the identity of any sequence elements and genes and possibly a map of the DNA with the sequence elements identified. Points will be awarded based on how extensive your interpretation is. Characterize the sequence using Serial Cloner or any other sequence analysis software you chose. Many of the program's tools will only be familiar to scientists and academics but there's also a web browser for the direct import of NCBI and EMBL entries.Below is a sequence of DNA. Obviously, the main aim of the program is to provide an easy way to clone DNA - a task which it does very well and mainly just using a graphical interface. You can numerically select fragments and carry out calculations of peptides which I have no idea about but certainly look impressive. All the tools you need to analyze and manipulate your DNA sequences are available in a very simple and easy to read all-in-one-window. ![]() It is therefore an extremely powerful piece of software that will only be of interests to scientists and science-biology students. Serial Cloner is freeware and is available for MacOSX and Windows Features ReadMe 2-5.pdf To Install Serial Cloner : Click on the Version you want to install. Serial Cloner is an application that allows you to read and write files DNA sequences that conform to the FASTA and pDRAW32 format. Basic Protocol 3 describes the design of primers to clone a gene of interest in a Golden Gate cloning vector. Basic Protocol 2 describes the domestication of a cloning vector to make a Golden Gate vector. The program includes a whole host of mapping options such as genetic maps, fragment viewers and a virtual PCR. Serial Cloner is a Molecular Biology software. Basic Protocol 1 (BP1) describes the Golden Gate (GG) cloning reaction and is part of all other protocols. ![]() Serial Cloner is an application that allows you to read and write files DNA sequences that conform to the FASTA and pDRAW32 format. Serial Cloner has been developed to provide a light molecular biology software to both Macintosh and Windows users. Until now, it reading and writing it was a very specialised field but this program intends to bring it to the masses. DNA is the complex code that makes up the lifeform in all of us. ![]() ![]() ![]() It forms a straight line with them when the stars come out over the eastern Canadian Maritimes. ■ The nearly full Moon shines just below Pollux and Castor during evening. By then it will probably be about mag 6.2, some 250 times fainter than Mars but still waiting for your binoculars or telescope. On the evenings of February 10th and 11th the comet will be less than 2° from Mars. After that, the Moon rises about an hour later each evening - affording dark views of the receding comet high overhead for the next two weeks as it moves south across Taurus toward the shield of Orion. On the evening of February 8th, with the sky now moonlessly dark for an hour or so after the end of twilight, the comet will be passing close by Iota Aurigae and probably t about magnitude 6.0. ![]() If/when the comet becomes too faint for that chart to suffice, use the more detailed one in the February Sky & Telescope, page 48 (where the dates are for 0:00 UT subtract one day from those to get the North American civil date.) (On that chart, the comet symbols are labeled with the dates for evening in North America, not the UT date.) See Bob King's article Understanding the Tails of Comet ZTF, with a finder chart for use in February. ![]() The comet is heading almost due south after its brush past the Little Dipper. Note the narrow, straight ion tail and the broad, curved dust tail. Comet ZTF E3, imaged on January 21st by Pepe Chambó of Valencia, Spain, using an 8-inch short-focus reflector. By February 10th it will probably be down to about 6.2. It reached magnitude 5.0 around the beginning of the month. But the Moon is gone from the early evening sky after February 7th, with the comet very high overhead in Auriga heading toward Taurus. Comet ZTF is fading and receding into the distance. ![]() |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |